Saturday, December 6, 2008

Largest Ever CFS Research Initiative Announced

(the posts I e-mailed the last two weeks didn't show up, so I've posted them manually tonight -- some formatting may have been lost in the process, but the goal was to get them up quickly, not to make them pretty ... sorry!)

Special AnnouncementDecember 3, 2008

CFIDSLink

Not a CFIDSLink subscriber? It's free.

Dear Friend, It's with great enthusiasm that we announce to our CFIDSLink readers the six research grants the CFIDS Association is awarding for the 2008-2009 cycle. Thanks to donations from people like you, we reached the unprecedented goal of raising $1 million to accelerate CFS research! As a result, the Association is awarding $647,940 to six research teams, the largest group of grants the Association has ever funded in one cycle. These researchers will be linked by the first-ever CFS research network, boosting the power of their individual studies through ongoing communication and collaboration. In a process led by our scientific director, Suzanne Vernon, PhD, each grant proposal underwent a rigorous review by a panel of independent scientific experts to ensure scientific merit and potential to yield productive insight into this illness. Read the stories below for more details.Research Matters Largest-Ever CFS Research Initiative AnnouncedThe successful completion of the million-dollar research campaign is enabling the CFIDS Association to institute a revitalized research program, called the Accelerate CFS Research Initiative. A key component of the initiative is our grants program, and today we announce details about six grants just awarded to research teams with expertise in a wide range of fields, including bioinformatics, microbiology, immunology and physics. The research we're funding covers a broad scope of investigations aimed at yielding the discovery of biomarkers and methods for early detection, objective diagnosis and effective treatment of CFS.Get the full story >> (in PDF format) Fostering Research: Our FoundationThe CFIDS Association of America has been funding and fostering the CFS research field for more than 20 years. Here's an inside perspective on the strategy behind our research program.Get the full story >> (in PDF format) Click here to learn more about the CFIDS Association's campaign that led to the Accelerate CFS Initiative.Back to topYour donations enable the CFIDS Association to fund CFS research, fight for better health policy, educate medical professionals and help families and individuals dealing with this debilitating illness. Donate now to support this work.

www.cfids.org

CFS and Allergies

A classmate who is now a doctor with the Mayo Clinic thinks CFS is caused by allergies; I think it’s the other way around. Many CFS patients report new or worse allergies.

For example, there’s an onion allergy that runs in my family. Even a small amount of onion in (for example) spaghetti sauce will have me writhing on the bathroom floor in 20 minutes, like clockwork. (Oddly enough, onion powder doesn’t bother me, and if I strain the solids out of French onion soup and eat only the broth, that sometimes doesn’t bother me, either, though on bad days I’ll react to any minute amount of onion juice.) My reaction is definitely worse now than it was before, when I could eat reasonable amounts of onion soup, onion rings, etc. with no problem.

But the one I know is new is a soy allergy that no one else in the family has. When I was a baby, the doctor prescribed a soy-based formula. I was a happy, healthy, chubby baby, so obviously it had no ill effects. I had vegetarian friends, and attended a lot of pot lucks where vegetarians donated food, so I know that I’ve eaten a lot of soy-based casserole in my life.

After getting CFS, I suddenly was allergic to soy. A friend who thought I was just saying I’m allergic to soy because I didn’t want to give up steak, tried feeding me a soyburger, and I admit that it tasted very much like the real thing. A few minutes later, I knew what I’d eaten, because the real thing doesn’t leave me wishing I would just die and end the pain. (And, unfortunately, it often takes exactly such a demonstration before people believe you that it’s not just a case of “I don’t like it”; I’ve heard more than one story about dinner parties being disrupted by a call to 911 because the hostess didn’t believe a guest’s allergy warning or thought “just a pinch” would be OK.)

I know precisely how much soy is safe – the two cubes of tofu in the miso soup at my favorite Japanese restaurant; if my companion stealthily tosses his miso in my soup and I eat a third cube, I need to get my entree to go. This, obviously, means I no longer accept invitations to vegetarian homes, and if they suggest a vegetarian restaurant, I interrogate the server with all the zeal of a prosecutor to be sure there is absolutely not one speck of soy in what I’m ordering.

If a restaurant order gets mixed up and served with onions after I’ve specified “no onions”, I make sure to do something to mark it (a slice off the steak, a rip in the surface of the burger bun) to ensure they didn’t just take off the onion and serve me the same food, which still has enough onion juice on it to set me off on a bad day.

One of the first books on CFS (Stoff/Pellegrino), http://www.amazon.com/Chronic-Fatigue-Syndrome-Jesse-Stoff/dp/0060922605/ref=sr_1_1?ie=UTF8&s=books&qid=1226995150&sr=8-1, contains a number of elimination diets to determine if your problems are, in part, caused by food allergies. Some people who actually have a gluten allergy have been wrongly diagnosed with CFS; some CFS patients will find their health improves a bit by avoiding certain foods (or, in my case, I’ve confirmed that I need a sugar rush first thing in the morning to wake up my brain, and that going vegetarian doesn’t give me enough protein to function optimally). But True CFS is caused by a virus, not by allergies, and if your health improves a little by avoiding certain foods, that just means you had an allergy you didn't previously know about.

Similarly, many people dispute the claim that patients have Multiple Chemical Sensitivity as being all in our heads, a convenient excuse to avoid work or chores or going places we don’t want to go. I can vouch for my MCS being the real deal: I have had notable symptom increases after walking through areas that I had no idea had been recently fertilized or painted; I would call the city or the apartment manager the next day and ask, and they would confirm that they had, in fact, been working in the area where I started to feel sick several hours before I walked through it.

Some doctors don’t believe in MCS, either. I had one who did, because she herself had reactions to certain chemicals. Whenever her office confirmed an appointment, they always ended by reminding the patient “no scented deodorant or bath products, no cologne” because many scents made her sick or started an asthma attack. She had no difficulty at all believing that the chemicals in odorless fertilizer or odor-dissipated paint could make me sick without any way of being conscious of their existence until I started tracking down the cause for my symptoms.

She was also the first doctor who confirmed my suspicion that I had asthma, because she was the first one who saw me gasping for breath. Until then, I’d been told “if you don’t make wheezing sounds, it’s not asthma”, even though everything else about the incidents fit. Because she had asthma herself, she knew more about it than the average PCP, and seeing it in action simply confirmed the diagnosis. I’d known all my life that if I stay under a certain level of exertion, I’m fine, and if I exceed it, I gasp for breath. It had nothing to do with the previous diagnoses of “out of shape” because it even happened when I was in the best shape of my life, exercising several hours a day – there were still things that were just that little bit more energetic that made me gasp for breath. (And then I blew out my knee and had a “valid” reason for refusing to run, so I didn’t have to go through the same argument about “you just need to get in shape” when being forced to run at full speed made me gasp for breath.)

Sometimes the best response to a doctor telling you that you’re imagining things is “were you there?” Because I can guarantee you, I did not see the doctor in the park just before I started feeling woozy from the fertilizer, and I did not see the doctor in my bedroom in the middle of the night when he is sure that I was sleeping and just imagining I was awake all night. I don’t care what “logic” they think they have on their side, I have facts on mine.

And one of those facts is the list of 5000+ studies worldwide proving there are biological reasons for the symptoms CFS patients report.

Beware of Amateurs!

Too many people think they know the explanation for your symptoms, but CFS is that “exception that proves the rule” in too many ways.

The most common is the misconception that CFS is nothing more than deconditioning and that you can exercise your way back to health. Unfortunately, for CFS patients, exercise can land you in bed, perhaps permanently. Dr. Cheney is quite specific: "Anaerobic Training: The anaerobic pathway is largely intact in CFIDS. Weightlifting, isometrics, and stretching can maintain muscle tone and strength and improve the elimination of toxins formed by the pathway itself. Do low level weight lifting with 1 to 20 pounds, using all muscle groups. Lift for 10 seconds, rest for 60 seconds - repeat for each muscle group. Do lift/rest cycles no more than 20 minutes three times per week. Sequential isometric contractions can be substituted for weight lifting. (This can be done while lying down.) Still use the 10 seconds on and 60 seconds off rule."

I can tell you from personal experience, I was starting to feel a bit better and thought I could take the risk, so (although I already knew from past experience what was going to happen, but wanted to document the times and durations more precisely) I decided to humor the doctor who insisted that I had to exercise, not make excuses, and followed his instructions to go for a walk every day. I watched my symptoms increase every day until the end of the week when I couldn’t even get out of bed; it took some time to return to the baseline I’d been at before I started the experiment. Argue with that empirical evidence, Doc!

As unusual as it sounds, the solution to the weakness of CFS is the same as the solution to the weakness of post-polio: not exercise, but rest. Dr. Bruno warns, every time patients “exhaust their motor neurons, they are doing damage that will eventually result in permanent weakness”. He observes that “deconditioning is one of the red herrings that doctors who know nothing ... try to feed you.” As are many of the other things non-experts will tell you; CFS has nothing to do with your weight, depression, malnutrition, or lack of exercise – it’s caused by a virus that affects the Central Nervous System.

If taking Vitamin X, Y or Z was the cure, don’t you think we’d know about it by now? There are vitamins and natural supplements that can help you feel a little better, but if you have a moderate-to-severe case, don’t think that a trip to the health food store is all it will take to get you back to work.

I tend to wake up with blurry vision that rights itself later in the day. Some of these helpful people have suggested I need new glasses (without considering they’d be the wrong prescription in the afternoon/evening when my vision clears). Others assert that at my age, it’s middle-aged presbyopia; my eye doctor disagrees – that occurs when your eyes get tired after being used most of the day, not first thing in the morning. But it doesn’t matter to these people that she’s got a degree in eyes; they know better. In fact, sporadic blurry vision is a typical CFS symptom, which has nothing to do with your glasses. Just to check the theory, I bought a pair of the most powerful drugstore reading glasses; all it did was create a much larger blur. The letters being larger, it was easier to guess at what they were through the fog, but it didn’t make anything clearer. There’s not a thing the eye doctor can do for this problem; new glasses won’t help – the problem (like many others in CFS) is a neurological dysfunction.

I was told for years that throwing up every morning was caused by anxiety, or eating things I’m allergic to, or (here’s a real joke) sticking my finger down my throat after a late-night binge. No one ever considered Dr. Bruno’s explanation: A “spasm pushes on the vagus nerve, slows the heart, drops the blood pressure, and turns on the gut, causing nausea and maybe a feeling of faintness – all because the functioning of the vagus nerve is discombobulated.” Much easier to tell me to cure it myself than to order a neurology consult. Although it’s possible that Dr. Bruno is in part right about what was causing my daily problems, my new doctor took seriously a report that I’d drunk a SlimFast and in the time it took to ricochet, it had already turned to cottage cheese. That indicated to him a seriously acidic stomach, so he asked some questions, which the prior doctors hadn’t thought necessary. The problem wasn’t what I was eating, it was what I was NOT eating: I was often collapsing into bed, totally exhausted, around 5 PM, which meant that for 12-18 hours, the only thing my stomach had to work on was my stomach. The problem was easily solved by keeping Saltines next to the bed so my stomach wasn’t empty that long, and taking two antacids at bedtime.

Similarly, our patients with Irritable Bowel Syndrome are also told it’s either anxiety or something they ate, when that also seems to be a problem with faulty nerve signals. (Definitely check to see if dietary changes help, but if pizza and chili don’t make it worse, there’s no need to give up your favorite foods; you’re suffering enough without doing that!)

As Dr. Bruno explains, malfunction in the vagus nerve can cause fainting. But I’ve been offered all sorts of amateur explanations: I’m hot, I’m cold, I’m dehydrated, I’m hypoglycemic... just fix the problem yourself! But drinking extra water, swallowing sugar by the spoonful, taking caffeine pills, turning on the A/C, don’t help me. In the late 1980s, the suggestion was made to increase low blood pressure by consuming more salt; since I was one of those health-conscious people who rarely used salt, I started putting salt on everything except my chocolate, and it didn’t do a thing to help me. But at least when I go to the doctor with fainting spells, I can tell him the things I’ve already tried, so he can rule out the simple solutions and address it at a medical level. I’ve been tested, there’s nothing permanently wrong, so whatever is causing it is a momentary glitch; I’ve repeatedly said that I feel better after my system “shuts down and reboots”, which adds to the likelihood that the problem won’t be found unless I’m hooked to a variety of monitors at the precise moment that whatever it is goes wrong.

People with absolutely no psychological training (maybe they’ve taken Psych 101) are always happy to diagnose CFS patients with psychiatric problems. When you say something that might be interpreted as “fear of ___”, they promptly tag you with phobias and anxiety, regardless if this is a perfectly rational concern (e.g., I was fainting on a daily basis and did not want to risk it happening in the middle of a busy street, so I didn’t go out alone). When you say “fatigue”, they slap a depression label on you. I’ve had doctors with no psych qualifications argue with the determination of a licensed psychologist/psychiatrist that I’m not depressed because I don’t have the necessary emotional factors to make that diagnosis; the doctor steadfastly insists that he is right and the psych is wrong. The psych actually asked me questions, didn’t just make the diagnosis on the single word “fatigue”. In fact, many of the symptoms of depression (including fatigue) are identical to the symptoms of a virus or other physical illness, so there is more required for an accurate diagnosis than just “fatigue”. The problem is, a lot of doctors’ training on psychiatric diagnoses are along the lines of those magazine quizzes “any 3 of these 8 symptoms”, and it’s not drilled into them that one of those has to be an emotional component, such as an irrational fear with no basis in fact, or feelings of worthlessness. You can’t definitively diagnose depression from the 4 symptoms it shares with the flu! (Which hasn’t stopped a lot of people from doing just that. And calling the patient “contrary” when the patient correctly points out that she doesn’t meet the diagnostic criteria for depression.)

Doctors are taught certain generic treatments that help a lot of conditions: exercise, stop smoking, stop drinking, give up coffee, give up white sugar, give up salt, go vegetarian. Unfortunately, many CFS patients were already following healthy habits (especially the athletes among us), so there are no bad habits to jettison. And, there’s a small problem for CFS patients in following this generic advice: according to Dr. Bruno, CFS patients tend toward hypoglycemia. “The more challenging the mental task – like those difficult attention tests – the more sugar neurons need to function.” While giving up sugar may help your teeth, it will probably deteriorate your mental function, and I’ve found that to be the case. Other studies have found CFS patients need extra protein to reach maximum functionality; I’m allergic to soy and can’t get enough protein from beans, so I either eat meat or I feel worse.

When someone comes up with one of these solutions, remember that CFS is a primarily neurological condition. It’s not going to be fixed by what you eat or don’t eat. (That said, you may find through experimentation that some foods do make you feel a little better or a little worse.)

Thank these “helpful” people for their suggestions, and then go home and follow the advice of the experts. CFS is a complex disease and cannot be fixed by simple solutions.

ME Informational Brochure Available


I just thought I would remind everyone about the Word copy of the A5 leafletof info on ME for the general public as Christmas approaches and likelihoodof more visitors - I am printing a dollop of them and giving a handful toall my visitors, carers etc and asking them to put them in docs surgeries,waiting rooms or take to work or whatever.NB. It is also a good way of getting friends/relatives to read them withoutsaying 'this is for you' LOLPlease let me know if you would like a copy and I will sent it backchannelor it is downloadable from the Meactionuk files section. It is in black andwhite to be cheaper to print.John Greensmith put the text of it on his websitehttp://www.mefreeforall.org/What-is-M-E-Leaflet.376.0.html We did it as the charities only target PWME and carers with very small printleaflets and only publicise their own charity - it can be amended to referto charities in other countries.

Von x

Please don't forget to search the net viahttp://www.everyclick.com/uk/meresearchuk/ and raise money for ME biomedical research just by clicking

Blame your genes for lengthy illness

[The US CDC paid for most of the cost of the Dubbo studies so probably paidfor most of this one (out of the CFS budget presumably). Tom]http://tinyurl.com/6a4nk8 i.e.http://www.theage.com.au/national/blame-your-genes-for-lengthy-illness-20081130-6noq.htmlBlame your genes for lengthy illnessSydneyDecember 1, 2008~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~Genes could explain why some people recover from the flu overnight andothers are still struggling with the dreaded lurgy two weeks on.Infectious disease experts in Sydney have discovered that people who carrycertain high risk genes are eight times more likely to suffer from a severeand prolonged illness when they have an infection.A smaller group of people have a genetic combination that makes themparticularly hardy, with a less severe illness."We all know that when people get sick some take a long time to recover andwhile others seem to get over it very fast, and what we've been able to showare the possible genetic reasons for this," said Dr Ute Vollmer-Conna, ofthe University of NSW.The study, published in the journal Clinical Infectious Diseases, is thefirst to explore the genetic determinants of the severity of sickness.It analysed differences in immune response among 300 people diagnosed withacute glandular fever, Ross River virus or Q fever infections in the centralwestern NSW town of Dubbo.Researchers looked at the genetic variants of five cytokines, proteinhormone messengers of the immune system which defend against infection.About 28 per cent had the genetic susceptibility to more severe andprolonged illness, while 18 per cent had protective genes.But it was too soon to say if the general population was affected to thesame extent, Dr Ute Vollmer-Conna said.She said those with the vulnerability have a overblown immune response."Some people will experience more severe symptoms than others when they areacutely sick with the same infection because their body's response is moreintense which in turn is due to their genetic make-up," Dr Vollmer-Connasaid."This group in the population were found to spend twice as many days in bedduring the acute illness and they also reported more than twice as many dayswhen they were unable to perform their normal roles and duties."The findings could ultimately help identify people who are vulnerable andgive them individualised prevention and treatment for common infectiousdiseases, and priority therapy in the event of a pandemic."In certain conditions, it may even be possible to save lives," she said.AAP

* * *
Hmmmmm.

All my life, it was joked that I didn't often get "sick" but on the rare occasions that I did, I got "deathly ill".

So, when the virus I had in 1987 was as severe as it was, it just seemed to be the usual that the stuff that got me was really bad, and that this more severe virus would take me down for longer than the usual 3 days most people have the flu.

And now it's even worse ... where most people get over the flu in 3 days, post-CFS it takes me 3 weeks.

Sick? Doctor's busy? Here's help - CNN.com

Sick? Doctor's busy? Here's help - CNN.com http://www.cnn.com/2008/HEALTH/12/04/doctor.emergency.appointment/index.html (excerpts)
1. Find your doctor's e-mail addressThis will require some Internet sleuthing, but it could be worth it.
2. Give TMI (too much information)Be specific about what's wrong. ... "Let them feel your pain; you want them to have sympathy for you and your sense of urgency."
3. Ask to speak to the manager"Be polite but persistent," says Dr. John Santa, director of the Consumer Reports Health Ratings Center.
4. Call first thing in the morningPlace your call the minute the office opens, and you'll greatly improve your chances of getting an appointment.
5. Go a little crazyAnother true story: One of Konowitz's patients, who was worried she had throat cancer, actually called a local TV station to complain when she couldn't get in to see him on short notice. Someone at the station called the public relations folks at the hospital where he works, who called him.
When all else fails, Konowitz advises that you just go to the doctor's office and plunk yourself in the waiting room.

* * *
The last was my cousin's advice (he's a medical professional in another state) when I couldn't get the doctor to agree to sign my disability paperwork. Since sitting up for hours would make me dizzy (if not faint entirely), he suggested I let someone in the doctor's office see how awful I look after a few hours, rather than my usual getting out of bed minutes before the appointment, which resulted in the doctor seeing me at my best. That might finally convince the doctor that I was not exaggerating about my inability to make it through an 8-hour work day even in a sedentary job.

If that didn't work, his advice was to threaten I was contacting a lawyer; he said the last thing any doctor would want to do is explain to a judge why a patient who describes such severe, disabling symptoms isn't able to get into the Disability system.

For those of you dealing with an HMO where you can't get an appointment for weeks (or months), and then more months to see any specialist he refers you to, another suggestion is to go to the top. Call the HMO administrators and tell them precisely why you need to see a doctor immediately, and what the consequences will be if you have to wait for months for an appointment. I finally got my specialist appointment by going to administration of the medical center with the complaint that my doctor's office wasn't returning my calls. They set me up with a second opinion, who referred me to the specialist.

As far as your doctor's e-ddress, if you can find an address for anyone in the same institution, they should all follow the same formula, whether it's firstname.lastname@, or an initial and a last name, or last name and then a name or initial, etc. Or you can simply try all the permutations possible for names and initials and hope for the best.

Or, do what I did -- change doctors. My current doctor can almost always get me in to see someone in his office the same day or next day. It may be the nurse practitioner or the physician's assistant, but once you're in the door, if it's truly urgent, the doctor will find a few minutes to come in to see you.

Pres. Obama wants your input ... so let's give him an earful

Here's where you can watch the video response from the emails receivedso far and below is the discussion and another place to comment if youwish to join THIS discussion....http://change.gov/newsroom/entry/join_the_discussion_daschles_healthcare_response/ Karen, please pass these 2 sites on to your other groups, OK?...and everyone...to any other health groups you belong to, OK?in gratitude,Nelcha---

bodieangels@... wrote:>> Our Pres-Elect is "ASKING" what we want> in Health Coverage....> > NOW is the time to tell everyone you know in this community> to SPEAK UP and tell him Please.....> > http://change.gov/agenda/health_care_agenda/ > > I am going to think before I write this one> but NOT for TOO long... I don't know HOW long we have...> > GO for it ;-)> > Nelcha>

Dr. Klimas' Presentation on Immune Markers

[This an unofficial transcript of Dr. Nancy Klimas' presentation entitled- "Immune markers in viral reactivation" International Symposium on Viruses in CFS & Post-viral Fatigue A satellite meeting of the 6th International Conference on HHV-6 & 7 in Baltimore, Maryland, USA Day 4 - June 23, 2008 - Immune markers & viruses session http://scivee.tv/node/7113 Items in [...] indicate transcriber additions/clarifications. [?] Indicates difficulty transcribing] [Dr. Klimas:] So I was asked to talk about immune changes in chronic fatigue markers, and also as I go along, to show how they might describe a- what might happen in a chronic viral condition. So I tried to set it up that way. In this course of this talk I'm putting my thank you's up first because I always run out of time and it's rude to not thank your collaborators, but much of what I'll be talking about today is Dr. Mary Ann Fletcher's work; she's right there, so you can ask her, no seriously we'll be talking about a lot of the immune stuff we've had a long history in our laboratory of doing a lot of the immunologic work and Dr. Fletcher has been the key player though all of that, we've had a lot of other wonderful colleagues and investigators- Suzanne Vernon's here today, it's a good group. And through many years of work, we've collected a lot of samples which is good. Slide 1- Model of CFS Pathogenesis Genetic Predisposition \/ Triggering Event/Infection \/ Mediators (Immune, endocrine, neuroendocrine, psychosocial, viral reactivation or persistence) \/ CFS/ME You've heard a lot about the- this sort of construct[referring to slide1] I think that Andrew[Dr. Andrew Lloyd] put this in his slide set that there might be a genetic predisposition, triggering, and so on. Today I'm talking about the immune thing but I really want to say, there's a lot of interaction that we're not talking about between the immune, the neuroendocrine, and the autonomic nervous system. And sometimes things are not as simple- as complicated as this all seems, they're not as simple as we might be presenting here. Slide 2- CFS "caseness" -Sub-populations- CFS - Immune, Autonomic, HPA When we look at "caseness" of Chronic Fatigue Syndrome, you've talked- and I think that Peter[Dr. Peter White] said this, that there's an umbrella case definition with a lot of symptoms in there, and there's more than one way to get 'that way', and this conference is very focused on the subgroup that might be suffering from viral re-activation. How big or small that subgroup is is yet to be defined but we've heard numbers as small as say, 17%, and as big as say, 82%, in this conference. So there's a lot of room there to argue about how big it is, but remember that these are overlapping, and the immune, the autonomic, and the neuroendocrine are overlapping. Slide 3- [picture of macrophage] So the immune system. First a little primer, I apologize to all you immunologists to be too simplistic, but you know, you don't really want to hear the whole thing, it's almost lunchtime. We'll just start with the easy thing. Usually when there's an infection the system- first off, when the immune system's working too hard, when it's activated, it's usually antigen driven- there's only so many ways you can over activate an immune system. And the pathonomonic thing in Chronic Fatigue Syndrome is this over activated immune system. So we talk about, in basic immunology, the immune system's antigen driven. Look for the antigen when you have an activated system. There's only so many things that can activate and drive a system- a pathogen, or more than one pathogen, an allergen, you heard yesterday about super-antigens, another possibility. And more recently there's some other little clues going out there about sympathetic nervous system activation of the immune system, sothere's a different thing that we don't hear about too much. And of course the other thing we're not speaking about, auto-immunity. So there- how many different ways might you turn on the on button and leave it pushed on, well maybe five different ways. And that's what the clues have here. So start with this cell, this macrophage[referring to Slide 3]. The macrophage usually presents the foreign antigen to the immune system(or even the auto-antigen). Slide 4 It presents it to the T-cells, T-helper cells, cytotoxic T-cells and so on, and the T-helper cells go about dividing and cloning out and making the armies of memory cells and effector cells that are going to deal with this infection. So- so we have this cascade of things- the macrophage, CD-4 cells, CD-8 cells, and so on. Now there's a divergence there, there's a cytotoxic T-cell that would go after more of the types of infections that happen within a cell, viral infections like the herpes human viruses, and then there's the types of things you want to see when you have a bacterial infection, particularly the big bad bugs, like pneumococcal or so on, when you really go after an antibody response. And then you are really driving the B-cells more and you're pushing that level. Slide 5- [picture of cytotoxic T-cell attacking EBV-infected cell] So a cytotoxic T-cell here is attacking this Epstein-Barr virus infected cell, and it's going to basically go up to the cell and shoot little pores, little tubes, into this cell and shove a bunch of enzymes into the cell that will destroy it and kill the virus in that cell. So the perforins make these tubes and the granzymes kick across into there, and you know, this cell just self-destructs leaving a perfectly intact cytotoxic T-cell to go off and kill another cell somewhere. Same thing happens with Natural Killer cells, it could be the same picture[referring to Slide 5]. Slide 6- Pro-inflammatory cytokine cascade (IL-1, TNF, IL6) So, huh, geez, I hate the way that Mac is screwing up the words and things[referring to Slide 6]. Ah, it's too bad. We're going to skip that slide. Let me tell you what the slide was going to say. It looked perfect on their screen back there. Basically, and again a little over-simplified, there's type-1 and type-2 cytokines. Type-1 cytokines, you've heard a bit about today, interferon alpha, IL-2, they go down the cytotoxic T-cell pathway and promote that type of cell to do their job. And type-2 cytokines are the ones that promote B-cells to be more effective and efficient in their job. Very frequently type-2 cytokines will down-regulate type-1, and vice-versa, a little see-saw. So you can drive a system into hyperdrive in one system or the other. So to give you a different example away from our field, in HIV, when a person's got a CD-4 count that's pretty normal, they're dealing with the infection and they're doing pretty well with it, they have a type-1 cytokine expression. When they shift to this type-2 through a series of things that happen to them, suddenly they get a much more rapid progression of their disease. So there's been a lot of focus in Chronic Fatigue Syndrome with the herpes family virus,worries that there- we should worry about type-1/type-2, and wonder if there might be an overdrive, and there's been a number of papers, including our own, that suggest there is, in the chronic phase of this illness, a type-1 drive. You heard today Andrew Lloyd and his group talking about maybe a type-1 initial response, but with a polymorphisms that are different, and that was very interesting; is there something wrong about that initial type-1 cytokine response, or something too extreme, or something that drives and triggers another series of downstream events to move things into chronicity, I thought that was fascinating. And it raises a lot of very interesting questions. Slide 7- Immune abnormalities in CFS Immune Activation Functional Defects -DR, CD26 expression NK Cell dysfunction -TH2 cytokine shift CD8 abnormalities -Pro-inflammatory \/ perforins, granzymes[\/ is downward pointing arrow] cytokines expression Macrophage abnormalities TNF-a, IL-1, IL-6 Antibody production -Increased apoptosis So the immune abnormalities seen in Chronic Fatigue Syndrome are characterized in this slide[Slide 7], and there are many cross-sectional studies but there are also many longitudinal studies now to go back to and look at these things. And you see a host of studies that document immune activation through a number of pathways. Flow cytometric studies of T-cell activation when you tag a lymphocyte with not just the cell- the identifier of the cell type, but also the kinds of receptors it would express where it activated and what they do, which is interesting, the types of cytokine patterns that happen, this type-2 shifting in Chronic Fatigue Syndrome that we've demonstrated and other groups talk about- some that have said no, some say yes, pro-inflammatory cytokine cascades- this is often misstated in conferences- anything that overdrives a system can turn on the pro-inflammatory cytokine cascade, it's not a type-1 or a type-2 specific phenomena, rather it's a system that'sturned on. And this TNF, IL-1, IL-6, you've heard a lot about that over the last couple of days, is turned on in the sickest group of Chronic Fatigue patients. Apoptosis is when a cell is been on so long it's been driven into cell death. If you push the on button so long that- and you don't release it, the cell will apoptose, and that's been shown in many different cell lines, including T-cells and neutrophils. Functional defects that we've shown and others have shown, Natural Killer cell dysfunction, cytotoxic T-cell abnormalities, the perforin and granzyme stuff I'm going to show you in a moment, and then macrophage antibody production abnormalities. We don't talk enough about macrophages, or antibody, or neutrophils, and yet they're very important in sustaining long term inflammatory responses, it's just work that's still to be done- hasn't been done yet. Slide 8 Now does it really matter, all this immune stuff we talk about, well this is some early work from ours, this is cognitive difficulty scales[referring to Slide 8], and when people have fairly normal T-cell functions- this is a PHA assay where you do the function of the cell in vitro in the lab- in the test tube, when they have fairly normal T-cell function they have fairly normal cognitive scales. But when they have very poor T-cell function they have much worse cognitive scales. Slide 9- [NK Cell Cytotoxic Activity- CFS vs. Controls] We've shown Natural Killer Cell function to be different in Chronic Fatigue Syndrome, and significantly different, we think this is a useful bio-marker. It's certainly one that circles an important group in Chronic Fatigue Syndrome, though it's a tedious assay, and sometimes it doesn't travel well so it's got some issues. Slide 10- [NK Cell Cytotoxicity. %K562 Cells Killed at Target to Effector Cell Ratio of...[?]] This is another study[Slide 10] where we looked at Gulf War Illness, Chronic Fatigue Syndrome- we perceive Gulf War Illness, which is very similar to Chronic Fatigue as a subgroup if you would of Chronic Fatigue. And NK, NK[referring to GWI and CFS- Slide 10] and normal, is very poor NK-cell function in both those groups. Slide 11- Medical Outcome Survey Short Form-36(SF-36) Women with CFS [low vs. normal NKCC] Now if you split the NK-cell group into- the Chronic Fatigue patients into fairly normal NK-cell function versus abnormal NK-cell function, you find that the SF-36, a functional scale- and this is the global SF-36 score[referring to Slide 11], is significantly different between these two groups, so again immune dysfunction is correlating with the severity of illness in this patient population. Slide 12- Paced Auditory Serial Addition Task(PASAT) Women with CFS [low vs. normal NKCC] The PASAT is an objective measure of: rate of information processing, sustained attention and divided attention A different objective marker of severity, this is the PASAT[Slide 12] and we've- you've heard that a couple times, the PASAT is a cognitive assessment that studies executive function, how well you're higher levels of thinking are working, if you would, and again a low NK and a normal NK split, and the more severely impaired NK-cell function people are having more impaired cognitive function. Slide 13- [Diagram of Natural Killer Cell- Cell Surface Antigen CD56, Intracellular Cytolytic Granules, Perforin, Granzyme A, Granzyme B] So shift for a moment to this Natural Killer Cell; what is this thing about. We've been talking about it not working well for a lot of years, Dr. Fletcher and the whole team in her laboratory are doing fabulous work with this trying to figure out what is wrong with this cell. [Slide 13- Perforin is a molecule in cytotoxic lymphocytes necessary for killing of virus infected and tumor cells] And one of the things we've looked at using flow cytometry, is the stuff inside the cell that does the killing. It's a nice way to try to get a sense of is there a functional defect of this cell, and you need to look at the perforins and the granzymes, the things that are chucked over into the target cell to kill the target cell, and we look at the- whether or not there's enough of that. And so we have the following data. Slide 14- Intracellular Perforin [Gulf War Illness- Chronic Fatigue Syndrome- normals] This is intracellular perforin[Slide 14] in the Gulf War and the Chronic Fatigue patients, and the normal controls, so they have abnormally low perforin content in their cells. Slide 15- Perforin[CFS vs. Controls, low NKCC vs. Hi NKCC] And if you split people into low function for Natural Killer Cells and high in the NK-cell, there's lower perforins in the less functional cells. Slide 16- Perforin[CFS vs. Controls, low NKCC vs. Hi NKCC] This is very interesting[Slide 16], and again that Mac back there is messing up the words slide, the- they have that little advertisement between Mac and Microsoft, I think- anyway, the- if you look at cytotoxic T-cells, this is very important, anyone that's an immunologist says 'ah, who cares about NK-cells because, hey, all the cytotoxic T-cells- they're so much more important, they're so much more efficient at viral killing than an NK-cell', an NK-cell could almost be seen as a backup system to these cytotoxic T-cell, but here we have the perforin content of the cytotoxic T-cell and irregardless of NK-cell function the perforin is poor in this cytotoxic T-cell. So cytotoxic T-cell functional studies are really hard to do, you have to do all this complicated stuff. Slide 17- Lymphocyte Activation in GWI and CFS: Percent of CD2+CD26+ Lymphocytes [GWI, CFS and Controls] This is probably the only study I know of in Chronic Fatigue[Slide 17] that looked at a surrogate for cytotoxic T-cell function and it says it's not there. We also looked at immune activation through various markers and one of the ones we liked the best, because it's got some interesting functions, is this CD26+ marker, it's basically sending the cell out of the periphery and into the tissues where it belongs after it's activated, and it has a lot to do with the regulatory function of immune activation, T-cell activation, and again we see it very high in the Chronic Fatigue and the Gulf War groups. Slide 18- Subjects- CFS n=168 vs. Controls n= 179, Gender- CFS82% Female vs. Control 84% Female, Age Range- CFS 23-80 vs. Control 25-60, Age Mean- CFS 44 vs Control 48 We take a very large group[Slide 18], 168 Chronic Fatigue and 179 Controls- largest one I've seen so far, [Slide 19- Dipeptidyl Peptidase IV (CD26)] and we see a significant difference across the board on the amount of cytotoxi- of CD26 expression on these cells. Now this is an important thing to see. There are more cells that are expressing this, there's more activation, but on a per cell basis, the ability of the cells to actually put that marker where it is on the receptor, which is a very important functional marker, is actually quite a bit lower than the controls. So there's more activation, but the functional ability of the cell to express that marker, the quantities of markers- of receptor you need on that cell is diminished and it's a very significant thing. Now an inexpensive way to look at that, because this is all flow cytometry so far, is to look at these markers that then fall off the cell and you can measure them as a soluble form of the marker. And you can see, as it is on the cell, as it is in the plasma, that there's less soluble CD26 circulating, and we think this is a very good biomarker forcircling the group that is Chronic Fatigue Syndrome. We tried to do an index score and it helps a little, but it's not as good as I think the soluble CD26 on it's own. Slide 19- Neuropeptide Y(NPY) is stored in sympathetic nerve terminals and is released along with catecholamines during stress induced activation.- NPY receptors are present most cells of the immune system, including NK-cells, NKY suppresses NKCC in vitro(Irwin, et al, 1991)- Only a few peptidases are capable of cleaving NPY due to its unique 3-dimensional structure.- DPPIV/CD26 is one such peptidase. So, that leads us to the next thing here, which is that the neuropeptide Y is another soluble mediator that's circulating and it's a powerful mediator. It's made by the sympathetic- it's being made by the sympathetic nervous system in the synapse of the sympathetic peripheral fibers, and it's cleaved by CD26, so if CD26 is down, neuropeptide Y might be up. Neuropeptide Y is a very active substance that has many functions across brain and immune system- systems. And so we looked at this thinking maybe this might be a biomarker that we could use in other ways. Slide 20-Neuropeptide Y -NPY(pmol/L) CFS = 102(S.D.= +/- 49)n= 93 vs. Controls = 80(S.D = +/- 35)n=101 (We measured the concentration of NPY in plasma samples using a quantitative radioimmunoassay from ALPCO Diagnostics(Salem, NH). This assay has a sensitivity of 3pmol/L and precision of 5%.) And sure enough we find Neuropeptide Y is elevated as compared to controls in a very significant way. Slide 21- Pearson Correlations(p<.3) Chronic Fatigue Syndrome Patients(42): Plasma Neuropeptide Y (pmol/L)[relationship between Neuropeptide Y and physical health/functioning] More importantly, and I put this one in for you [Dr.]Peter White, I hope you're in the room- you'll love this, all you guys looking for biomarkers for symptoms love this, it correlates in the right direction for many things. Neuropeptide Y- the higher it is, the worse the function of the patient, it also correlates with a number of the neurocognitive and mood states, in the- a way that you would predict. So it's lovely, it might be the very first decent marker that we might use for managing, that's accessable for looking at people across time and against severity of illness with specific mood states. Slide 22- CFS PATIENTS- Cognitive Capacity Screening Examination This one-[ref. Slide 22] just happens to be cognitive against Neuropeptide Y going in the right direction there. Slide 23- Summary: 1. The immunologic changes seen in CFS and in GWI are consistent with that seen in chronic viral illnesses, though subgroups exist. 2. Immune dysregulation has been extensively studied, and patterns that would reasonably leave the subject vulnerable to viral reactivation have been shown. 3. In considering clinical trials, consideration of immune modulators should be considered; possibly together with antiviral therapies. So to sum, because the red light is flashing and it's lunchtime- to sum, the immune changes that we see in Chronic Fatigue Syndrome I think are absolutely what you should see in a chronic viral state, the cells that clear viruses that are latent- that are trying to reactivate, the very cells that prevent reactivation of latent viruses are the ones that are most dysfunctional. It's an important point to be made, ok? And the state of chronic immune activation is something that would trigger 'baggage DNA', Dr. Williams I say this for you- baggage DNA, and allow the virus to express what it knows how to do, including any latent virus stuff that's in there. So the retrovirus talk yesterday, Dr. Williams' talk on EBV dUPTase- very, very important to have a chronic immunologically activated state to achieve that, as well as any virus that is actually capable of replication on its own. So the immunologic state seems very reasonable to continue to hypothesize viruses might well beinvolved in the chronicity of this illness. We've looked at a lot of reasons why they are dysfunctional, I think we're very far along in understanding that; I would say when you're looking at antiviral trials, just like in any other chronic viral state, you have to say 'What is going to be left if you cleared the virus? Is the immune system going to be healthy enough to maintain that?' And you might want to be considering both immunomodulator and antiviral combination trials as time passes by and hope to be able to- to drop a person back into an immune system ready to hold them, if you would, once you get viral loads back down. Slide 24- 1. NKCC and intracellular perforin are biomarkers for CFS- but expensive and not widely available. 2. % CD2+26+ lymphocytes, rmolCD26 on lymphocytes and sCD26 in plasma are likely to be biomarkers for CFS. 3. NPY is elevated in CFS. This may be an important biomarker, and has high correlation with cognitive symptoms and psychometric markers. The Natural Killer Cell is a good surrogate marker for the severity of illness, the function, so is the perforin content, so is the granzyme content, it's also important to recognize the cytotoxic T-cell is equally affected. Finally these biomarkers coming from immunology-land might be very very useful in clinical trials, we're hoping to see both CD26 and Neuropeptide Y put in to a number of different studies we have ongoing- a lovely natural history study we call the 'Good day, bad day' study to see what's fluctuating with time, and we hope to answer that question for you in some future conference. So I'd like to thank all the people that paid for our work, including the CFIDS Association of America who are in the room, thank you very much, and the conference organizers because this is one fabulous conference. Thank you very much.

PatientsLikeMe.com

http://www.miamiherald.com/living/health/healthAP/story/788784.html The above link will lead you to a site which amongst other things supports patient driven medical trials:"'My ultimate frustration that drove this site into existence was an overall feeling that there was a lack of transparency and speed or urgency" by the medical system, said Jamie Heywood, who co-founded PatientsLikeMe months before his own brother died of ALS......Despite the risks, [Edward] Langston of the AMA pointed out that doctors often stumble upon treatments, and patients could possibly do the same. 'If patients are willing to share their experiences, that may in fact occur,' he said."The first step is to get ME-CFS on their pages; I've signed on using the terms myalgic encephalomyelitis, CFS. It might have been better if I'd signed on for ME. I encourage patients & caregivers to sign in. The site promises to include more illnesses and will let patients know when the specified illness is included.This could be very very important. So many of us benefit from IV saline, but of course it's a devil to do a double blind study with. Using this site, or perhaps a site like it, we can demonstrate how many benefit from the therapy (just an example).The site has been around since 2004."Physicians and researchers can also access the social networking health site, enabling them to find out what treatments its patients have tried and how successful the outcome of the treatments were. The site has also introduced a number of projects that analyze clinical information given by the patients. Users of the site use the site for free. However the site is still a commercial site as it aims to sell its user’s data to drug and medical companies. The number of users is increasing. At May 2008, there were more than 5000 users with multiple sclerosis, 2000 users with mood disorders, 2000 users with amyotrophic lateral sclerosis, 700 users with HIV and 1600 users of the site with Parkinson’s disease.In the time since, the company has expanded to 5 disease categories, with future plans to expand to many more. The company was named as one of the "15 Companies that Will Change the World" by Business 2.0 and CNN Money[1]. It was also featured in a March, 2008 New York Time Magazine article entitled "Practicing Patients."[2]" from Wikipedia.Jean Harrison

Beware of Miracle Cures

Thanks to Dr. John for spotting this one:
An article in The Weekly News, 29 November 2008 --- (appears ahead of datebecause it is a weekly publication) --- warns chronically ill people to bewary of miracle cures, highlighting a free download publication called "I'vegot nothing to lose by trying it.", produced bywww.senseaboutscience.org.uk and endorsed by several organisationsrepresenting chronically sick people,such as MS, Motor Neurone, Alzheimer's, Parkinson's disease.The article is not online but we have typed it in our news section.You can read my letter in response to it herehttp://www.mefreeforall.org/November-2008.1327.0.html#c6287 when logged in and, from there, click to the original.It's an especially good time to respond to articles like these.We only need a dozen to get a letters special - as in the Daily Mail, acouple of days ago.If you can manage one, the e-mail address is weeklynews@dcthomson.co.uk Make it no more than a cople of sentences, or you've no chance.

* * *
There are always those who will prey on people desperate for a cure.

Some years ago, I was referred to a website that supposedly offered a miracle cure. Reading the fine print, they claimed only a 20% success rate, which was not enough to persuade me that it was worth the gamble, especially as I had crossed the line into the first stages of the severe category. Obviously, I needed something that had a better success rate among those who are seriously ill, and not those who are only mildly affected.

A lot of "CFS experts" are actually treating garden-variety fatigue, which they are mistakenly calling CFS (or intentionally calling CFS to induce desperate patients to spend money on a treatment that has nothing at all to do with the neurological illness we have).

Before you try any of these "miracle cures", ask around, see if someone else in a support group has any information about it. They may tell you that it contains something you're allergic to (which many of the miracle cure doctors won't tell you until you've paid for the first appointment), or that it didn't offer any benefits, or that the cure was based around aerobic exercise (which someone with CFS should not do).

Amnesty International and CFS

Thanks to Sam for this:


Long ago, I worked as a volunteer for Amnesty International,a human rights watchdog. I found them to be professional,rational, committed, non-partisan, and respected.I do not know now if I can get in touch with any of thepeople I volunteered with. But I do know that the treatmentof people with m.e. is a human rights violation.This is not hyperbole. If you have the real m.e., the onethat causes severe suffering and death, then you are havingyour human rights violated, with deliberate neglect,malpractice and, in many cases, abuse.Please get used to this idea, instead of assuming that youdon't deserve rights, or that the right thing is being done.You do and it isn't. I assumed those things too. If youare confused about what a human right is, look it up. AIfights for health rights. m.e. qualifies, period.My suggestion is that each of us, worldwide, contact ourlocal Amnesty International group and talk to a volunteer inthat group.To find your local group: ask around, look in your phonebook, check your local university, or use the web. Trysearching "amnesty international [your city or university]".A sure-fire way is to go to http://amnesty.org/ . Thedrop-down menu labeled "In your country:" will get you alist of regional offices for your country. Then, call yourregional office to find your city's local office.I have some suggestions. Of course, they are justsuggestions: 1) Don't be afraid. These people are friendly. Their goal is to make the world a better place. 2) Each group around the world usually calls for action in other countries. So don't get overly focused on any one institution in your own country. This injustice is global. We fight for each other. - This means that even if you are not in the UK or USA, you still have a voice about the MRC and the CDC. 3) If you know the basics, they can take over the research. - But know the basics. If you don't know why the CDC definitions are harmful, then this is not for you. If you keep up with Co-Cure and know about: conflicts of interest, attempts to destroy the ICD, Sophia Mirza, etc., then this might be for you. 4) Be calm, focused, dignified. Do it when you are less fogged. Also, pay attention to accuracy. Many volunteers are academics, and will appreciate that. 5) Have good reference materials. If you do not, they will go to Google and see propaganda from one side and rants from the other. They are open-minded, but give yourself a chance to be credible. - Give them something that explains the real disease (*not* smokescreen stuff about "CFS"), both medically and politically, preferably in a good scientific journal. - I like http://www.meactionuk.org.uk/What_Is_ME_What_Is_CFS.htm , but there might be something better. (I am new to all of this, so please tell me.) - Know that Wikipedia, which is one place they will look, is wrong. The m.e. page does not even exist (it points to CFS). *All* pages related to m.e. have grossly insufficient checks and balances against conflicts of interest, astroturfing, abuse of admin powers, bigotry, intellectual laziness, spin, etc. More good editors are necessary. (Perhaps *you*.) - Know that many otherwise reputable medical web sites are also wrong. - Just explain that m.e. is a real, ordinary, severe disease, just like multiple sclerosis or lupus. - Encourage them to do their own research, and promise them that it will yield fruit. Tell them that an unbiased science-oriented person will readily discover that vicious politics is being dressed up as science. - If an organization of their stature doesn't stand up for right, *then who will*? The world needs their moral courage. 6) Point out the historical pattern of bigotry. Show that it is no better than other forms. - Multiple sclerosis was called "hysterical paralysis" just a few decades ago. Parkinsons's was fear of masturbation. Morning sickness was the mother's desire to abort the fetus. Autism was "refrigerator mothers". I could go on. - The recent Gulf War Syndrome report might have useful things in it. 7) Point out systemic problems. When good scientists can't get published without toeing the line, that's a systemic problem. When millions of people don't get treated as full human beings as a result of systemic problems, then AI can -- and must -- do something. 8) Use a compelling image or fact in addition to (obviously not instead of) logic, and back it up. It is good to draw from your own experiences. This fixes it in their minds, so just use one or two. Here are some examples that might be possibilities: - Bigotry that you have experienced. - I was denied proper medical care on many, many occasions. - Doctors are not being told the truth about my disease. - How employers treated you. - I was diagnosed (with the vague epithet "CFS") 10 years before I found out about it, because the HMO never bothered to tell me. - Any undeclared conflicts of interest that you know about. - Any scientific misconduct that you know about. - Deaths are not being recorded as being from their ultimate cause. - m.e. is being excised from textbooks. - Funded less than hay fever? - Zero biomedical research funding by MRC. - Funding irregularities by CDC. - Sophia Mirza: http://www.sophiaandme.org.uk/sophia%20&%20m.e.%20her%20story.html - Ean Proctor. (Caution: I don't know much about this as there isn't a lot on the web. As with everything here, do your homework.) http://www.ahmf.org/ww-ean.html - A billboard during the Olympics at a major airport that depicts CFS as pleasant: http://www.angelfire.com/ri/strickenbk/images/billboard.gif 9) If you are not housebound, show your face. It is *absolutely critical* to explain that there are others who are even sicker so do not fail to say this. If you are housebound, invite the person over once you establish a rapport. If you are a carer, be persistent and friendly and invite the person over. 10) Only if you feel like it, tell me how well it worked and in which city (or cities).And one final suggestion: - Waiting for a cure does not work. This disease has been recognized in the medical literature since the 1930's. Without more and more people becoming active (even if all you can do is just a single phone call) we will die before the cure. No question about it.If AI includes m.e. in its report, or starts a campaign, itwill be in newspapers globally. Governments will be shamedand will do the right thing to cover their behinds. You,personally, can make a difference. If you act.Action item for today: find your local AI group.P.S. After AI, you can contacthttp://www.hrw.org/en/topic/health ("Human Rights Watch iscommitted to researching and advocating on behalf ofpopulations that are being denied their right to health")andhttp://en.wikipedia.org/wiki/International_Federation_of_Human_Rights . And you can find others and post them for the rest of us.All relevant HR watchdogs need to know.-- Myalgic encephalomyelitis denialists are knowingly causing furthersuffering and death by opposing biomedical research on this seriousinfectious disease. Do you care about the world?http://www.meactionuk.org.uk/What_Is_ME_What_Is_CFS.htm

Presentation by Dr. Natelson

[From an E-mail from Patient Alliance for Neuroendocrineimmune DisordersOrganization for Research and Advocacy, Inc. (Pandora)http://www.pandoranet.info ]Rare Opportunity for Interactive Dialogue With World-Renowned CFS/ME ExpertDaniel Moricoli is is the force behind the CFS Seminar in West Palm Beach,FL, featuring Dr. Benjamin Natelson.Saturday, December 13, 2008, in West Palm Beach, Florida,CfsKnowledgeCenter.com is hosting a seminar featuring Dr. Benjamin Natelson,of the Pain & Fatigue Study Center in New York City who will present aunique program of patient-physician interaction.Dr. Natelson is a world-renowned expert in both CFS and fibromyalgia. Finalarrangements are underway to have him joined by two other experts equallyhighly regarded in their respective field of CFS study and treatment. Thiswill be an event that I am sure all of us will find informative andstimulating on our respective paths towards wellness.Advance reservations are a must. Go towww.cfsknowledgecenter.com/events.html for updates and additionalinformation about this very special event. You may also email the eventsponsor directly at events@cfsKnowledgeCenter.com .Please share this message and forward it to everyone you know who would findit of interest.~~~~~~~~~~~~~http://www.cfsknowledgecenter.com/events.html December 13, 2008"Dr Benjamin Natelson on Facing & Fighting Fatigue "Location:West Palm Beach, FLFeatured Guest Speaker:Dr. Natelson, one of the foremost authorities on CFS/ME in the world, isalso the author of two patient-centric books on CFS/ME: Your Symptoms areReal as well as Facing & Fighting Fatigue, a practical approach.Dr. Natelson will be speaking about fatigue and chronic fatigue syndrome. Hewill focus on his four step pathway to wellness. The event will follow aninformal, conversational format to maximize full interaction with theaudience.The session will be structured much like an office visit with Dr. Natelsonexcept that much more detail will be covered and it will cost a merefraction of the $750 that he must charge for an office visit of two hoursduration.The program is designed specifically to provide attendees with extensivetime for questions and follow up with Dr. Natelson. The event is sponsoredby the cfsKnowledgeCenter. Proceeds will be used to offset the developmentcost of this website.Tickets:Admission is $45 for registered members of the cfsKnowledgeCenter withconfirmed reservations made before November 15, 2008. Admission is $65 forregistered members with advance reservations thereafter. Non-members andsame day admissions are $85 as space allows.Links and Downloads:For additional details and reservations, email inquiries to the followinglink: Events events@cfsKnowledgeCenter.com events @ cfsKnowledgeCenter.com

Medical Bias Against Women

An NBC News report says that women are 30% less likely than men to get necessary liver transplants; they get too sick to withstand the surgery and die before they get their new liver.

Other statistics over the years have shown that women are more likely to die of their first heart attack than men; doctors simply don’t take their symptoms seriously until it’s too late. An ER nurse I know online told of badgering male doctors for an entire shift to order a test, and they’d just glance into the room, note that it was a youngish woman of normal weight, and diagnose anxiety or heartburn without even approaching the patient because she didn’t fit the stereotype of the kind of woman who would have a heart attack. At shift change, the nurse finally got a female doctor to order the test, but the patient died in the elevator on the way up to the testing room.

In fact, many female patients report that their symptoms are downplayed by male doctors, they’re given inaccurate emotional diagnoses for what are really physical problems. For that reason, female doctors are so much in demand that one local HMO in my area limits assignments to female doctors to those women who have religious prohibitions against seeing male doctors – they simply don’t have enough female doctors to accommodate all the women who would rather deal with a woman who takes their symptoms seriously.

It’s happened to me, too. When I first got sick in 1987, my boss and I had similar symptoms; mine were much worse. When both of us had our first-round tests come back normal, his doctor put him on a plane to the far end of the state for specialized testing, mine diagnosed “you want to be a housewife” and refused to look any further for a reason for the symptoms. Under rigorous questioning, I finally remembered that, yes, I did have a pending legal matter; despite the fact that it was in the hands of a top lawyer who assured me that the law was 100% on my side, and I was so mellow about the outcome that I’d effectively forgotten about it until the doctor specifically asked “are you involved in any lawsuits?”, it gave the doctor something on which to hang a diagnosis of “anxiety” to absolve himself of further responsibility for tracking down the real cause of the symptoms.

As I continued to get worse without treatment, my boss asked “have you been tested for this and that?”, and was stunned when I reported the doctor had not done any further testing after the first round of tests were negative; my diagnosis was “nothing wrong”. Seeing first-hand the different treatment a male and a female received for the same symptoms, we had to acknowledge that medical bias against women was alive and well, and had not gone away just because women were supposed to be treated equally under the law.

Dr. Bell notes in his book that fully half the patients who are initially given such a brush-off diagnosis are eventually diagnosed with a very real physical disease. Yet, no matter how many statistics are amassed to show that women do not receive equal medical treatment, the bias continues. It is not coincidence that 3/4 of CFS patients are women and 3/4 of CFS patients report a bad experience with doctors.

How many more patients need to die or become permanently disabled before doctors come into the 21st century, where women are just as likely as men to want careers? Not one of the doctors who dismissed me with “you don’t want to work” ever even asked the questions that would have led him to the information that I had a long career behind me and never had any desire to be a housewife. They just “knew” that that was the deepest desire of every woman.

Women are not too lazy to work, we don't all want to be housewives, we're not all emotionally fragile, and it's high time that the medical community acknowledge their misogynistic view of women is inaccurate and deadly.

If you feel that your doctor has been dismissing your symptoms because you're a woman, report it to Administration of the medical group. If your symptoms have gotten much worse as a result of this attitude, don't hesitate to call a medical malpractice lawyer. Only by having to answer for their actions are they going to learn that it's not acceptable to treat women differently from men.

Complement activation in Chronic Fatigue Syndrome

Source: Molecular Medicine Uncorrected ProofDate: November 16, 2008URL: http://www.pubmedcentral.nih.gov/picrender.fcgi?artid=2583111&blobtype=pdf http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=19015737 Rem: Running title: Complement activation in chronic fatigue syndrome Transcriptional control of complement activation in an exercise model ofChronic Fatigue Syndrome------------------------------------------------------------------------Bristol Sorensen(1), James F. Jones, Suzanne D. Vernon(2), Mangalathu S.Rajeevan(3)- Division of Viral and Rickettsial Diseases, National Center for Zoonotic, Vector-borne and Enteric Diseases, Centers for Disease Control and Prevention, Atlanta, GA, USA 30333;1 Department of Integrative Biology, University of Colorado at Boulder, Boulder, CO;2 The CFIDS Association of America, 6827 Fairview Road, Suite A, Charlotte, North Carolina 28210 3 Author for correspondence: Mangalathu S. Rajeevan, Centers for Disease Control and Prevention, 1600 Clifton Road, MSG 41, Atlanta, GA, USA 30333 Ph 404-639-2931, Fax 404-639-3540; E-mail: mor4@cdc.gov ABSTRACTComplement activation resulting in significant increase of C4a split productmay be a marker of post-exertional malaise in chronic fatigue syndrome (CFS)subjects. This study was focused to identify the transcriptional control thatmay contribute to the increased C4a in CFS subjects post-exercise.Differential expression of genes in the classical and lectin pathways wereevaluated in peripheral blood mononuclear cells (PBMCs) using quantitativereverse transcription PCR. Calibrated expression values were normalized tointernal (peptidylpropyl isomerase B [PPIB]) or external (ribulose -1,5-bisphosphate carboxylase/oxygenase large subunit [rbcL]) reference genesor geometric mean (GM) of genes ribosomal protein, large, P0 (RPLP0) andphosphoglycerate kinase 1 (PGK1). All nine genes tested, exceptmannose-binding lectin 2 (MBL2), were expressed in PBMCs. At 1 hrpost-exercise, C4, mannan-binding lectin serine protease 2 (MASP2) andficolin 1 (FCN1) transcripts were detected at higher levels ( 2-fold) in atleast 50% (4 out of 8) of CFS subjects that increased to 88% (7 out of 8) CFSsubjects when subjects with over-expression of either C4 or MASP2 werecombined. Only increase in MASP2 transcript was statistically significant[PPIB, p=0.001; GM, p=0.047; rbcL, p=0.045]). This may be due to thesignificant but transient down-regulation of MASP2 in control subjects (PPIB,p=0.023; rbcL, p=0.027). By 6 hrs post-exercise, MASP2 expression was similarin both groups. In conclusion, lectin pathway responded to exercisedifferentially between CFS and controls subjects. MASP2 down-regulation mayact as an anti-inflammatory acute-phase response in healthy subjects, whereasits elevated level may account for increased C4a and inflammation mediatedpost-exertional malaise in CFS subjects.Key words: Post-exertional malaise; C4a split product; Gene expression;Classical and lectin pathways; InflammationINTRODUCTIONChronic fatigue syndrome (CFS) is a medically unexplained illness identifiedby self-reported symptoms and exclusionary conditions. Efforts to identifydiagnostic markers for CFS remain challenging. Discovery of biomarkers mayhave been impeded by the fact that the unique biologic changes responsiblefor the original illness production may no longer be present in mostprevalent cases of CFS identified by various clinical case definitions (1,2).However, a consistently observed case defining symptom in CFS subjects is theexacerbation of symptoms following exercise (post-exertional malaise) asopposed to the relief from symptoms following exercise in patients with otherfatigue-associated conditions like depression, rheumatoid arthritis, systemiclupus erthymatosus and multiple sclerosis (3-6). Further, post-exertionalmalaise was one of the key symptoms in the Centers for Disease Control (CDC)symptom inventory list that differentiated subjects with chronic fatigue fromnon-fatigued subjects (7). In a principle component analysis to delineateheterogeneity in medically unexplained fatiguing illness, post-exertionalmalaise was the highest loading factor among a data set of 38 independentclinical and laboratory measurements (8). Thus, available evidence indicatespost-exertional malaise to be a unique and a major case defining symptom,necessitating focused studies on its clinical and molecular characterization.Identification of specific biologic changes associated with post-exertionalmalaise offers a promising approach for the discovery of biomarkers of CFS.Since clinical evaluation of patients with sickness behavior to identifyinfectious or inflammatory diseases indicated complement activation insubjects with CFS, we previously used an exercise paradigm to determinealterations in complement split products and found that exercise induced asignificant increase of C4a, a putative anaphylatoxin, at 6 hrs afterexercise only in CFS subjects (9). Mean symptom scores and mean scores forreduced activity and mental fatigue categories of Multidimensional FatigueInventory were also significantly increased in these CFS subjects followingexercise. Two complement split products universally accepted asanaphylatoxins, C3a and C5a, were not elevated in the CFS subjects. Amicroarray study with probes for 3800 genes and using total RNA fromperipheral mononuclear cells (PBMCs) of these subjects also identifieddifferences in complement activation between CFS and control subjectsfollowing exercise (10). Together, these results demonstrate that complementactivation may be a marker of CFS associated post-exertional malaise, andthat the exercise induced complement activation, particularly leading to theincreased level of C4a split product, may be regulated at the transcriptionallevel.C4a is generated from the cleavage of the native complement protein C4 viathe classical and lectin pathways. In the classical pathway, C4 is cleaved byC1s activated by C1q whereas in the lectin pathway, C4 is cleaved bymannan-binding lectin serine protease 2 (MASP2) activated by mannose bindinglectins (MBL) or ficolins (FCN). Some pro-inflammatory cytokines are known tomodulate the synthesis of the above proteins both at the mRNA and proteinlevels. C1q mRNA and proteins are reported to be stimulated byinterferon-gamma (IFN-gamma), IFN-alpha, IFN-beta, and interleukin-6 (IL-6) (11-13). The secretion of the serine protease C1s can be enhanced by eitherIFN-alpha or IFN-gamma (14). C4 expression both at the protein and mRNAlevels can be regulated by IFN-gamma, IFN-alpha, and IL-6(15-19). On anotherlevel, increased C4 may be available for cleavage if C1-inhibitor (SERPING1),which removes the active enzymes C1s and MASP-2 from their respectivecomplexes they form with C1q and ficolins, becomes transcriptionallyrepressed. Increased levels of C4a can thus be hypothesized to result fromany one or more transcriptional changes associated with increased amounts ofthe initiating proteins of the classical and/or lectin pathway, increasedamounts of pro-inflammatory cytokines that may stimulate the production ofthe initiating proteins of the complement pathway, or repression in theinhibitory regulation of the classical or lectin pathways. Based on the abovehypothesis, we examined changes in the expression of several genes in thecomplement pathway by real-time reverse transcription PCR (real-time RT-PCR)as the first step in testing the molecular basis of altered complementmetabolism following exercise.MATERIALS AND METHODSSubjects and blood collectionThe CDC Institutional Review Board, as required by the Department of Healthand Human Services regulations, approved the study. This study used a subsetof subjects (8 CFS and 7 Control) from a previous case-control study thatidentified a significant increase of C4a split product at 6 hrs post-exercisein CFS subjects (9). All subjects were recruited from the National JewishMedical and Research Center (NJMRC), Denver, CO. CFS subjects (mean age 37.5p/m 6.61 and 87.5% females) were volunteers from the outpatient consultationclinic of NJMRC whereas control subjects (mean age 28.3 p/m 3.80 and 43%females) were derived from the diagnostic complement laboratory of NJMRC. Except for 1 Asian subject in the control group, all study subjects wereCaucasians. It should, however, be noted that while age and sex of the CFSand control subjects were matched in the previous C4a split product study(9), this matching was not retained in the present study. Further, no attemptwas made to stratify the data based on age and gender because of the smallsample size, and report of no difference in the activation of complementpathways with regard to age or gender in normal healthy subjects (20). Allsubjects performed 20 minutes of a sub-maximal steady-state exercise on astationary bicycle ergometer. Blood was collected from all subjects byvenipuncture into tubes containing heparin immediately before exercise (T0 ),1 hour post-exercise (T1), and 6 hrs post-exercise (T2). PMBC's wereseparated from blood using Ficoll gradient and stored as pellets at -70 Cuntil used for RNA extraction.RNA isolation and quantificationTotal RNA was isolated from PBMCs using RNAqueous (Ambion Inc., Austin, TX)according to the manufacturer's recommendations, and stored at -70 C untiluse. RNA quality and quantity were determined using the RNA 6000 Nano Assaywith the Bioanalyzer (Agilent Technologies Inc., Palo Alto, CA). RNA qualitywas also assessed by denaturing agarose gel electrophoresis. All RNA sampleswere of good quality in terms of intactness of ribosomal bands as determinedby both the Bioanalyzer and agarose gel electrophoresis.LightCycler-based real-time RT-PCRLightCycler-based real-time RT-PCR with SYBR Green I dye detection andmelting curve analysis for product specificity was used to determine thetranscript levels. cDNA synthesisA 20 mul reverse transcription (RT) reaction was set up corresponding to eachsample using 0.5g of total RNA spiked with 1pg (300 copies/cell) of plantmRNA, ribulose -1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL)(Strategene, LaJolla, CA) to determine the efficiency of RT-PCR reactions ingeneral, and as an external reference gene for normalization of geneexpression. A single tube reaction method was used to treat total RNA withDNase I to remove traces of contaminating DNA (21). Total RNA containingplant mRNA spike was digested with 4 units of DNase I (MessageClean Kit,GenHunter Corp., Nashville, TN ) in 12.8 mul reaction that contained 1.8 mul5X first strand RT buffer (Clontech, Palo Alto, CA). DNase I digestion wasperformed for 30 minutes at 37 C, and terminated at 72 C for 2 minutesfollowed by incubating on ice immediately. One microliter of DNase I treatedRNA was removed, diluted 1:10 with water, and set aside as no-RT controltemplate for PCR to determine the effectiveness of DNase I treatment. Theremainder of the DNase I treated RNA was supplied with 300 ng of randomhexamers (Invitrogen, Carlsbad, CA), and incubated at 72 C for 10 minutes andthen placed on ice. The reaction was finally brought up to 20 mul with 2.2mul of 5X first strand buffer (Clontech), 2 mul of 100 mM DTT, 2 mul of 10 mMdNTP (Invitrogen,) and 2 mul of PowerScript reverse transcriptase enzyme(Clontech). Each RT reaction was incubated at 42 C for 60 minutes, and thenterminated at 72 C for 15 minutes. To avoid degradation of RT product fromrepeated freezing and thawing, working stocks (1:5 dilutions of original RTproduct) were prepared in water, and stored at -20 C until used.Determination of LightCyler PCR conditions and setting up reactionsThe optimal annealing and signal acquisition temperatures for allgene-specific primers (Table 1) and product specificity were determined asdescribed earlier (22) with a calibrator cDNA synthesized as above usingUniversal Human Reference RNA (Strategene) mixed with total RNA from PBMCs ofhealthy volunteers. These optimal conditions enabled the signal acquisitionto be set 1-2 C below the Tm's of the specific product, minimizing signalinterference from non-specific products. PCR efficiency of each primer setwas determined using the optimal conditions and 2-fold serial dilutions(range 0.25 ng to 16 ng/PCR) of calibrator cDNA (Table 1).The LightCycler 2.0 Software version 4.0 (Roche Diagnostics Corp.,Indianapolis, IN) was used to set up the reactions. First, 2 mul of DNAMaster SYBR Green I mixture (containing Taq DNA polymerase, dNTP, MgCl_2 andSYBR Green I dye; Roche Molecular Biochemicals) was incubated with 0.16 mulof TaqStart Antibody (Clontech) for 5 minutes at room temperature prior tothe addition of primers and cDNA. Each final 20 mul reaction contained 2 mulof 1:2.5 dilution of cDNA working stock, 0.4 M each primer and 4 M MgCl2. Thethermal cycling conditions were as described previously (22) butincorporating the optimized annealing and signal acquisition temperatures foreach gene-specific primer (Table 1). Effectiveness of DNase I treatment wastested for all cDNA synthesis with primers for glyceraldehyde-3-phosphatedehydrogenase (GAPDH) and no-RT control template.Experimental design and statistical analysis:Determination of the fold differences in gene expression involved running 4separate experiments: experiment 1 to generate standard curve for target gene(run as absolute quantification) using calibrator cDNA; experiment 2 togenerate standard curve for reference genes (run in absolute quantification)using calibrator cDNA; experiment 3 for target gene amplification in unknownsamples along with calibrator cDNA (run in relative quantification, monocolormode); experiment 4 for reference gene amplification in unknown samples alongwith calibrator cDNA (run in relative quantification, monocolor mode). Datafrom all 4 runs were imported to the relative quantification application(monocolor) of the LightCycler software version 4 to determine efficiency-corrected crossing point (Cp) and normalized ratio as represented by theformula below. Normalized ratio = Target gene concentration /reference gene concentration in unknown sample = ------------------------------------------------------------------------- Target gene concentration/reference gene concentration in calibratorNormalized ratio to a calibrator sample (Universal Human Reference RNA,Stratagene) was derived to minimize LightCycler run to run variation asrecommended to assure uniformity from multiple runs and intra orinter-laboratory comparisons (23). Fold-difference in gene expression betweencases and controls were determined from their normalized ratios as determinedabove. Fold-differences were calculated with respect to normalized ratiosderived of individual endogenous reference (peptidylpropyl isomerase B[PPIB]) or external reference (rbcL) genes or using the geometric mean (GM)of the normalized ratios of the reference genes (ribosomal protein, large, P0[RPLP0] and phosphoglycerate kinase 1 [PGK1) determined by the g-Normsoftware. The rationale for these different normalization approaches usingPPIB (24) or external spike (25,26) or geometric mean (27) for real-timeRT-PCR has been published elsewhere.For the purpose of this study, we defined a gene as over or under-expressedif 50% or more of CFS subjects showed >= 2-fold change in expression comparedto the median of control group as determined by at least 2 of the 3normalization methods. Further, normalized ratios were log10 transformedprior to statistical analyses in StatView (Acton, MA, USA) to testsignificant differences (p-values <0.05) n="88;">= 2-fold over-expression ofeither C4 or MASP2 at T1 by at least 2 of the 3 normalization methods.On further analysis, only differential expression in MASP2 was statisticallysignificant between CFS and control groups at T1 using all 3 normalizationmethods (PPIB, p=0.001; GM, p=0.047; rbcL, p=0.045) (Figure 1A-C).Differential expression of C4 at T1 was significant (p=0.032) only with thedata normalized by the PPIB (Fig 1.D). It appears from this analysis (Fig 1A-D) that MASP2 and C4 in control healthy subjects were down regulated for atleast 1 hr post-exercise, followed by rise in their transcript levels to thebaseline by 6 hrs post-exercise. This down regulation at T1 compared to T0was significant only with MASP2 transcript levels normalized by PPIB (p =0.023) and rbcL methods (p=0.027), with borderline significance by GMnormalization (p=0.056). MASP2 transcript level at T2 did not differ betweenCFS and control subjects or when compared with T0 and T1 levels in both CFSand control subjects, except that the increase from T1 and T2 in controlsubjects was significant when transcript levels were normalized by the rbCLmethod (p=0.0143).DISCUSSIONThis study reports the first systematic evaluation of complement geneexpression in PBMCs. Of 9 complement genes tested, transcripts for all genesexcept MBL2 were detected in PBMCs indicating that complement gene activityis not restricted to specialized cells like hepatocytes. Lack of MBL2expression in PBMCs agrees with previous reports but MBL2 can be induced invitro in adherent monocyte and monocyte-derived dendritic cells (28). Whileexpression for some genes (C1Q, C4 and FCN1) was detected in PBMCs as inearlier reports (29-31), MASP2 expression was not detected previously inPBMCs (28). Initiation of classical pathway is antibody dependent but lectinpathway is antibody independent and begins with the recognition and bindingof sugars or N-acetyl groups on pathogenic cells (pathogen-associatedmolecular patterns) by MBL or ficolins. Based on the pattern of transcriptsdetected, genes belonging to both classical (C1QA, C1S) and lectin (ficolinsand MASP2) pathways are expressed in PBMCs, with the lectin pathway activatedby local synthesis of ficolins rather than MBL2.The major focus of this study was to determine if gene expression differencesin the complement system would correlate with the previous observation ofincreased C4a split product in CFS subjects 6 hrs post-exercise. Initialanalysis identified transcripts of C4, MASP2 and FCN1 at higher levels(>=2-fold) in at least 50% (4 out of 8) of CFS subjects at 1 hrpost-exercise, and the percentage of CFS subjects responding to complementgene expression increased to 88% (7 out of 8) when subjects withover-expression of either C4 or MASP2 were combined. Further analysis byt-tests identified significant difference in the level of MASP2 mRNA betweenCFS and control subjects at 1 hr post-exercise. This difference in MASP2 mRNAappears to be due to a significant but transient down-regulation in controlsubjects. By 6 hrs post-exercise, MASP2 expression was almost similar in bothgroups. This significant change in MASP2 expression at 1 hr post-exercise wasidentified independent of the method used for normalization, indicating thatthe observed role of MASP2 mediated lectin pathway in response to exercise islikely to be reproducible, in spite of the small sample size used in thisstudy. It may, however, be noted that the reference genes (RPLPO and PGK1)used in the GM normalization method may be targets to some extent, asindicated by the apparent inversion of MASP2 expression in CFS compared tocontrol subjects.The current data do not directly address the activation of complement systemduring or following exercise. Whatever the trigger, it may involve activationof monocytes since they may be a common source of C4, MASP2, and ficolins.Binding of ficolins in conjunction with MASP2 to C4 initiates cleavage of C4leading to the release of C4a (along with other components of the classicalpathway). Both FCN1 (M-ficolin) and FCN2 (L-ficolin), located in chromosome9q34 and separated by 22 kb, were detected in PBMCs with FCN1 expressed athigher level in PBMCs than FCN2 and also differentially expressed between CFSand control subjects. Although FCN1 has been until recently solely associatedwith monocytes, neutrophils, and spleen cells and hypothesized to be asecretory protein(32), it has recently been found in serum in lowconcentrations (33). If released by monocytes, FCN1 could bind to a varietyof its ligands, acetylated sugars or proteins, which are abundant during orfollowing exercise (34,35)Previous reports of serum or plasma levels of complement activation productssuggest that C activation takes place immediately with exhaustive exercise(36) but more slowly in the subjects in this study undergoing sub-maximalexercise (9). The trend of down-regulation of expression with return tobaseline levels in controls subjects that precedes by several hours theactivated proteins is in keeping with built-in regulatory processes inherentin the complement system. By contrast, expression of several complement genesremained at higher level in CFS subjects before and post-exercise indicatinga lack of acute phase transcriptional response by these genes which may leadto localized and uncontrollable inflammation mediated tissue damage (37). Thelectin pathway may also be activated by translocation of microbial productsfrom the gut postulated to occur during exercise (38) or other events such asinfection, injury or vaccine that can trigger local inflammation and avariety of autoimmune diseases (39). Either situation may lead to increasedC4a in CFS subjects compared to controls, and this C4a may have a regulatoryrole in inflammation by inhibiting monocyte chemotaxis (40) or throughfunctions similar to C3a "activator and inhibitor" sequences as proposed byErdei et al.( 2004)(41). An anti-inflammatory role would coincide with thedown-regulation of MASP2 expression in control subjects, 1 hr post-exercise.Mechanisms regulating the expression of MASP2 are currently unknown, exceptfor a report on a weak stimulatory effect by IL-1B that is abolished by IL-6(42), and a putative role for the transcription factor Stat 3 in itsexpression (43). Our bioinformatics analysis of MASP2 promoter byMatInpsector revealed several transcription factor binding sites includingtwo potential glucocorticoid responsive elements (GRE) located withinnucleotide positions -154 to -136, and between positions -989 to -971(positions numbered with respect to transcription start site). A central rolefor hypothalamic-pituitary-adrenal (HPA) axis in modulating post-exertionalmalaise in CFS subjects in the context of hypocortisolism has been discussedin the literature (44-46) without mechanistic explanations. Steroid treatmentstudies report a reduction or a general down-regulation of complementactivation by glucocorticoids (47-49). Based on the presence of GRE in MASP2promoter and glucocorticoid's anti-inflammatory response in general, it ishypothesized that in control subjects exercise induces cortisol secretionwhich inhibits MASP2 transcription through GRE, whereas at least in asubgroup of CFS subjects, exercise induced cortisol secretion is below athreshold (hypocortisolism) to inhibit MASP2 expression. Although cortisolwas not measured in this study, other studies have reported significantincrease in cortisol, and its correlation with post-exercise performance inhealthy subjects (50-53). Accumulating evidences suggest that physicalexercise, depending on the kind of exercise and subject characteristics, canact as a powerful modulator of HPA axis and influence central nervous systemfunctions in general (54,55). Complement system, either alone or interactingwith pro-inflammatory cytokines, may be a potential link in the bidirectionalcommunication between the HPA axis and immune functions that are likely to bealtered in subjects with CFS (56).Our findings should only be generalized in light of limitations of the studydesign. The previous study that reported the significant increase in C4asplit product (9) and the current study examining the transcriptional changesin complement genes used subjects from the same recruitment. Age and sex ofthe CFS and control subjects were matched in the C4a split product study butthis matching was not retained in the present study. We examined geneexpression changes in PBMCs, a non-invasive source of sample for biomarkerdiscovery and validation. PBMCs, however, are mixtures of lymphocytes andmonocytes, and as such the findings do not reflect cell-type specificresponses. Further, it remains to be addressed if the observedtranscriptional changes in complement genes are reflected in their plasmaprotein levels.In conclusion, this study detected expression of both classical and lectinpathways in PBMCs of normal healthy and CFS subjects, but transcripts forcomponents of the lectin pathway (C4 and MASP2) were observed at higher levelin CFS subjects 1 hr post-exercise. Higher expression of C4 and MASP2 maycontribute to the increased C4a split product in CFS subjects 6 hr postexercise. MASP2 expression was significantly down-regulated in controlsubjects 1 hr post-exercise, and this down-regulation may be mediated by theanti-inflammatory effect of cortisol in response to exercise. Further studiesare needed to replicate the differential expression of complement genes andits potential link with inflammation and cortisol secretion in response toexercise.ACKNOWLEDGMENTSSupport for B. Sorensen was provided by the research participation program atthe Centers for Disease Control and Prevention (CDC), National Center forZoonotic, Vector-borne and Enteric Diseases, Division of Viral andRickettsial Diseases, administered by the Oak Ridge Institute for Science andEducation through an interagency agreement between the U.S. Department ofEnergy and the CDC. The authors wish to acknowledge the laboratory support ofDr. Irina Dimulescu, bioinformatics support of Dr. Virginia Falkenberg andthe valuable comments and critical reading of the manuscript by Dr. ElizabethR. Unger.DISCLOSURESNo authors of this manuscript have any actual or potential conflict ofinterest including any financial, personal or other relationships with otherpeople or organizations that could inappropriately influence, or be perceivedto influence this work. The findings and conclusions in this report are thoseof the authors and do not necessarily represent the views of the fundingagency.FIGURE LEGENDFigure 1. Changes in the expression of MASP2 and C4 in CFS and control (CON)healthy subjects at baseline (T0) and at 1 hr (T1) and 6 hr (T2) followingexercise. (A) MASP2 expression level normalized by PPIB method. (B) MASP2expression normalized by geometric mean (GM) using g-Norm software. (C) MASP2expression normalized by external plant spike, rbcL transcript. (D) C4expression normalized by PPIB. P-values in bold indicate significantexpression differences in MASP2 and C4 between CFS and control subjects atT1. P-values in italics indicate significant difference in MASP2 expressionbetween different time points in response to exercise in control subjects.TABLESTable 1. Gene-specific primer sequences, LightCycler run conditions and PCR efficiencies.---------------------------------------------------------------------------------------------------Gene name GenBank Primer sequence (5'->3')^A Product Annealing/ PCR(Gene symbol) Accession# Size Acquisition Efficiency (bp) temperature---------------------------------------------------------------------------------------------------Complement component 1,q NM_015991 FW: GGCAGCCCAGGAAACATCAAGGAC 143 65/87 1.96 subcomponent, A chain RV: AATCGGCCGGAGTGGTTCTGGT (C1QA)Complement component 1,s NM_001734 FW: CATGGATGGGGACCTGGGACTGA 150 65/84 1.99 subcomponent (C1S) RV: GCCTCTGCATCTGCTGTGGGTTTCComplement component 4 NM_007293 FW: GGGGCCCCACGTCCTGCTGTAT 141 65/89 2.00 (C4) RV: CTGCGCTCGGGGTTGTAGTAGTCGMannose-binding lectin 2 NM_000242 FW: ACAAACTGGAACGAGGGTGAA 151 65/85 2.00 (MBL2) RV: CAGATGGGAGGTGGAGCAGMannan-binding lectin NM_006610 FW: TATGAAAAGCCACCCTATCCA 105 60/84 1.99 serine protease 2 RV: TGCCCCTCCGCTGTCAC (MASP2)Ficolin 1 (FCN1) NM_002003 FW: CGCCGACTGTCATGCTTCAAACCT 97 65/82 2.05 RV: GTACCCCTTCGCCGCACTCCAGFicolin 2 (FCN2) NM_004108 FW: GAACCAGCGAGCTCCGTGTAGACC 125 65/83 1.95 RV: GAAGGCCCCCAGGACCAGATTGTComplement component 1 NM_000062 FW: ACAGCAGCAGCCCCAGAGTCCTAA 100 65/84 1.97 inhibitor (SERPING1) RV: AGCCGGCTGATCTTGTTGTTGGTGInterferon gamma NM_000619 FW: TTGGGTTCTCTTGGCTGTTACTG 167 65/78 1.99 (IFN-gamma) RV: TGGCTCTGCATTATTTTTCTGTCAPeptidylpropyl isomerase M60857 FW: AAGGGGCCCAAAGTCACCGTCAAG 261 65/82 1.95 B (PPIB) RV: GGGGAAGCGCTCACCGTAGATGCPhosphoglycerate kinase NM_000291 FW: GCAGATTGTGTGGAATGGTC 101 65/81 1.98 1 (PGK1) RV: CCCTAGAAGTGGCTTTCACCRibosomal protein, large, NM_001002 FW: AAACTCTGCATTCTCGCTTCCTG 119 65/83 1.98 P0 (RPLPO) RV: GACTCGTTTGTACCCGTTGATGATEukaryotic elongation NM_001402 FW: TGCGGTGGGTGTCATCAAA 123 65/84 2.00 factor 1 (EEF1A1) RV: AAGAGTGGGGTGGCAGGTATTGRibulose -1,5-bisphosphate U91966 FW: ATTAGATGGCCAAGAGTAGATGAA 83 57/73 1.99 carboxylase/oxygenase RV: AAAAAGATTGAGCCGAGTGC large subunit (rbcL)Glyceraldehyde-3-phosphate X01677 FW: ACCACAGTCCATGCCATCAC 450 58/86 1.95 dehydrogenase (GAPDH) RV: TCCACCACCCTGTTGCTGTA---------------------------------------------------------------------------------------------------^A FW=forward primer; RV= reverse primerTable 2. Reproducibility of reference genes determined by coefficient of variation in Crossing points (Cp) ---------------------------------------------------------------------------Gene Symbol Mean Cp value p/m SD (n=88) Coefficient of variation ---------------------------------------------------------------------------EEF1A1 17.79 p/m 1.49 8.37 RPLP0 21.69 p/m 1.38 6.36 PGK1 25.20 p/m 1.67 6.64 PPIB 23.15 p/m 1.15 4.95 rbcL 25.33 p/m 0.66 2.61 --------------------------------------------------------------------------- Table 3. Over or under expression of complement genes as defined by 50% of CFS subjects that showed 2-fold expression changes in response to an exercise challenge compared to the median of control groupA.---------------------------------------------------------------------------Gene Normalization method ------------------------------------------------------------- PPIB GM rbcL ------------------- ------------------- ------------------- T0 T1 T2 T0 T1 T2 T0 T1 T2C1Q^A - 62.5 57.14 - - - 50.00 - -C1S - - - - 62.50 - - - -C4 - 75.00 - - 62.50 - - 62.50 -MASP2 62.50 62.50 57.14 - 50.00 - 50.00 62.50 -FCN1 - 62.50 - - 50.00 - - 62.50 -FCN2 50.00 50.00 - - - - - - -SERPING1 - - - 50.00 - - - - -IFN-gamma 62.50 - - 50.00 50.00 57.14 - - ----------------------------------------------------------------------------^A Only values for >=50% of CFS subjects that showed 2-fold differentialexpression compared to the median of the control group are shown. Hyphenatedcells indicate no differential expression. Values indicating down regulationare underlined. Because of a missing sample, values under T2 (in italics)indicate percentage with a denominator of 7 CFS subjects as opposed to T0 andT1 percentage values with a denominator of 8 CFS subjects. PPIB=normalization by the internal reference gene PPIB; GM=normalization bygeometric mean; rbcL=normalization by the external reference gene rbcL.T0=pre-exercise baseline, T1=1 hr post-exercise; T2=6 hr post-exercise. Numbers in lightly shaded cells indicate differential expression by MASP2 andIFN-gamma at T0 by at least two methods of normalization. Numbers in darklyshaded cells indicate differential expression in C4, MASP2 and FCN1 at T1 byall three normalization methods.Reference List1. Fukuda K, Straus SE, Hickie I, Sharpe MC, Dobbins JG, Komaroff A. (1994) The chronic fatigue syndrome: a comprehensive approach to its definition and study. International Chronic Fatigue Syndrome Study Group. Ann.Intern. Med. 121:953-959.2. Reeves WC, Wagner D, Nisenbaum R, Jones JF et al. (2005) Chronic fatigue syndrome - a clinically empirical approach to its definition and study. BMC.Med. 3:19.3. Dunn AL, Trivedi MH, Kampert JB, Clark CG, Chambliss HO. (2005) Exercise treatment for depression: efficacy and dose response. Am.J.Prev.Med. 28: 1-8.4. Bearne LM, Scott DL, Hurley MV. (2002) Exercise can reverse quadriceps sensorimotor dysfunction that is associated with rheumatoid arthritis without exacerbating disease activity. Rheumatology (Oxford) 41:157-166.5. Robb-Nicholson LC, Daltroy L, Eaton H, et al. (1989) Effects of aerobic conditioning in lupus fatigue: a pilot study. Br.J.Rheumatol. 28:500-505.6. Mostert S, Kesselring J. (2002) Effects of a short-term exercise training program on aerobic fitness, fatigue, health perception and activity level of subjects with multiple sclerosis. Mult.Scler. 8:161-168.7. Wagner D, Nisenbaum R, Heim C, Jones JF, Unger ER, Reeves WC. (2005) Psychometric properties of the CDC Symptom Inventory for assessment of chronic fatigue syndrome. Popul.Health Metr. 3:8.8. Vollmer-Conna U, Aslakson E, White PD. (2006) An empirical delineation of the heterogeneity of chronic unexplained fatigue in women. Pharmacogenomics. 7:355-364.9. Sorensen B, Streib JE, Strand M, Make B, Giclas PC, Fleshner M, Jones JF. (2003) Complement activation in a model of chronic fatigue syndrome. J Allergy Clin Immunol. 112:397-403.10. Whistler T, Jones JF, Unger ER, Vernon SD. (2005) Exercise responsive genes measured in peripheral blood of women with chronic fatigue syndrome and matched control subjects. BMC.Physiol. 5:5.11. Gulati P, Lemercier C, Guc D, Lappin D, Whaley K. (1993) Regulation of the synthesis of C1 subcomponents and C1-inhibitor. Behring Inst.Mitt.196-203.12. Kolosov M, Kolosova I, Zhou A, Leu RW. (1996) Autocrine induction of macrophage synthesis of complement subcomponent C1q by endogenous interferon-alpha/beta. J.Interferon Cytokine Res. 16:209-215.13. Walker DG. (1998) Expression and regulation of complement C1q by human THP- 1-derived macrophages. Mol.Chem.Neuropathol. 34:197-218.14. Drouet C, Reboul A. (1989) Biosynthesis of C1r and C1s subcomponents. Behring Inst.Mitt.80-88.15. Collins T, Winkelstein JA, Sullivan KE. (1996) Regulation of early complement components C3 and C4 in the synovium. Clin.Diagn.Lab Immunol. 3:5-9.16. Kulics J, Circolo A, Strunk RC, Colten HR. (1994) Regulation of synthesis of complement protein C4 in human fibroblasts: cell- and gene-specific effects of cytokines and lipopolysaccharide. Immunology. 82:509-515.17. Sacks S, Zhou W, Campbell RD, Martin J. (1993) C3 and C4 gene expression and interferon-gamma-mediated regulation in human glomerular mesangial cells. Clin.Exp.Immunol. 93:411-417.18. Seelen MA, Brooimans RA, van der Woude FJ, van Es LA, Daha MR. (1993) IFN- gamma mediates stimulation of complement C4 biosynthesis in human proximal tubular epithelial cells. Kidney Int. 44:50-57.19. Vincent F, de la SH, Bohbot A, Bergerat JP, Hauptmann G, Oberling F. (1993) Synthesis and regulation of complement components by human monocytes/macrophages and by acute monocytic leukemia. DNA Cell Biol. 12: 415-423.20. Zimmermann-Nielsen E, Svehag SE, Thorlacius-Ussing O, Baatrup G. (2001) ELISA for evaluating the incorporation of plasma derived complement split- products C3b/iC3b into solid-phase immune complexes. J.Immunol.Methods. 249:43-5121. Huang Z, Fasco MJ, Kaminsky LS. (1996) Optimization of Dnase I removal of contaminating DNA from RNA for use in quantitative RNA-PCR. Biotechniques. 20:1012-1020.22. Rajeevan MS, Ranamukhaarachchi DG, Vernon SD, Unger ER. (2001) Use of real-time quantitative PCR to validate the results of cDNA array and differential display PCR technologies. Methods. 25:443-451.23. Skrzypski M. (2008) Quantitative reverse transcriptase real-time polymerase chain reaction (qRT-PCR) in translational oncology: Lung cancer perspective. Lung Cancer. 59:147-154.24. Pachot A, Blond JL, Mougin B, Miossec P. (2004) Peptidylpropyl isomerase B (PPIB): a suitable reference gene for mRNA quantification in peripheral whole blood. J.Biotechnol. 114:121-124.25. Bower NI, Moser RJ, Hill JR, Lehnert SA. (2007) Universal reference method for real-time PCR gene expression analysis of preimplantation embryos. Biotechniques. 42:199-206.26. Gilsbach R, Kouta M, Bonisch H, Bruss M. (2006) Comparison of in vitro and in vivo reference genes for internal standardization of real-time PCR data. Biotechniques. 40:173-177.27. Vandesompele J, De PK, Pattyn F, Poppe B, Van RN, De PA, Speleman F. (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3:RESEARCH003428. Seyfarth J, Garred P, Madsen HO. (2006) Extra-hepatic transcription of the human mannose-binding lectin gene (mbl2) and the MBL-associated serine protease 1-3 genes. Mol.Immunol. 43:962-971.29. Fan Q, Weill B, Delpech M. (1994) Study of C4A mRNA in mononuclear blood cells from a patient with SLE and C4A homozygous deficiency without C4A gene deletion. Clin.Exp.Rheumatol. 12:657-660.30. Lu J, Le Y, Kon OL, Chan J, Lee SH. (1996) Biosynthesis of human ficolin, an Escherichia coli-binding protein, by monocytes: comparison with the synthesis of two macrophage-specific proteins, C1q and the mannose receptor. Immunology. 89:289-294.31. Moosig F, Damm F, Knorr-Spahr A, et al. (2006) Reduced expression of C1q- mRNA in monocytes from patients with systemic lupus erythematosus. Clin.Exp.Immunol. 146:409-416.32. Endo Y, Matsushita M, Fujita T. (2007) Role of ficolin in innate immunity and its molecular basis. Immunobiology. 212:371-379.33. Honore C, Rorvig S, Munthe-Fog L, Hummelshoj T, Madsen HO, Borregaard N, Garred P. (2008) The innate pattern recognition molecule Ficolin-1 is secreted by monocytes/macrophages and is circulating in human plasma. Mol. Immunol. 45:2782-2789.34. Watt MJ, Heigenhauser GJ, Dyck DJ, Spriet LL. (2002) Intramuscular triacylglycerol, glycogen and acetyl group metabolism during 4 h of moderate exercise in man. J.Physiol. 541:969-978.35. White LJ, Robergs RA, Sibbitt WL, Jr., Gasparovic CM, Petropoulos H, Brooks WM. (2006) Accumulation of acetyl groups following cycling: a 1H-MR spectroscopy study. Int.J.Sports Med. 27:100-104.36. Dufaux B, Order U. (1989) Complement activation after prolonged exercise. Clin Chim.Acta. 179:45-4937. Markiewski MM, Lambris JD. (2007) The role of complement in inflammatory diseases from behind the scenes into the spotlight. Am.J.Pathol. 171:715- 727.38. Shek PN, Shephard RJ. (1998) Physical exercise as a human model of limited inflammatory response. Can.J.Physiol Pharmacol. 76:589-597.39. Nancy AL, Shoenfeld Y. (2008) Chronic fatigue syndrome with autoantibodies - The result of an augmented adjuvant effect of hepatitis-B vaccine and silicone implant. Autoimmun.Rev. 8:52-55.40. Tsuruta T, Yamamoto T, Matsubara S, et al. (1993) Novel function of C4a anaphylatoxin. Release from monocytes of protein which inhibits monocyte chemotaxis. Am.J.Pathol. 142:1848-1857.41. Erdei A, Andrasfalvy M, Peterfy H, Toth G, Pecht I. (2004) Regulation of mast cell activation by complement-derived peptides. Immunol.Lett. 92:39- 42.42. Endo Y, Takahashi M, Kuraya M, Matsushita M, Stover CM, Schwaeble WJ, Fujita T. (2002) Functional characterization of human mannose-binding lectin-associated serine protease (MASP)-1/3 and MASP-2 promoters, and comparison with the C1s promoter. Int.Immunol. 14:1193-1201.43. Unterberger C, Hanson S, Klingenhoff A, et al. (2007) Stat3 is involved in control of MASP2 gene expression. Biochem.Biophys.Res.Commun. 364:1022- 1025.44. Baschetti R. (2005) Chronic fatigue syndrome, exercise, cortisol and lymphadenopathy. J.Intern.Med. 258:291-292.45. Glass JM, Lyden AK, Petzke F, et al. (2004) The effect of brief exercise cessation on pain, fatigue, and mood symptom development in healthy, fit individuals. J.Psychosom.Res. 57:391-398.46. Van Den EF, Moorkens G, Van HB, Cosyns P, Claes SJ. (2007) Hypothalamic- pituitary-adrenal axis function in chronic fatigue syndrome. Neuropsychobiology. 55:112-120.47. Ernst E, Espersen GT, Andersen MV. (1990) Reduction of complement activation in rheumatoid arthritis by steroid treatment. Int.J.Tissue React. 12:77-79.48. Packard BD, Weiler JM. (1983) Steroids inhibit activation of the alternative-amplification pathway of complement. Infect.Immun. 40:1011- 1014.49. Zimmermann-Nielsen E, Gronbaek H, Dahlerup JF, Baatrup G, Thorlacius- Ussing O. (2005) Complement activation capacity in plasma before and during high-dose prednisolone treatment and tapering in exacerbations of Crohn's disease and ulcerative colitis. BMC.Gastroenterol. 5:31.50. Li TL, Cheng PY. (2007) Alterations of immunoendocrine responses during the recovery period after acute prolonged cycling. Eur.J.Appl.Physiol. 101:539- 54651. Minetto MA, Lanfranco F, Baldi M, Termine A, Kuipers H, Ghigo E, Rainoldi A. (2007) Corticotroph axis sensitivity after exercise: comparison between elite athletes and sedentary subjects. J.Endocrinol.Invest. 30:215-223.52. Rojas VS, Struder HK, Vera WB, Schmidt A, Bloch W, Hollmann W. (2006) Acute BDNF and cortisol response to low intensity exercise and following ramp incremental exercise to exhaustion in humans. Brain Res. 1121:59-65.53. Minetto MA, Lanfranco F, Tibaudi A, Baldi M, Termine A, Ghigo E. (2008) Changes in awakening cortisol response and midnight salivary cortisol are sensitive markers of strenuous training-induced fatigue. J.Endocrinol. Invest. 31:16-24.54. Leal-Cerro A, Gippini A, Amaya MJ, Lage M, Mato JA, Dieguez C, Casanueva FF. (2003) Mechanisms underlying the neuroendocrine response to physical exercise. J.Endocrinol.Invest. 26:879-885.55. Dishman RK, Berthoud HR, Booth FW, et al. (2006) Neurobiology of exercise. Obesity (Silver.Spring). 14:345-356.56. Lorusso L, Mikhaylova SV, Capelli E, Ferrari D, Ngonga GK, Ricevuti G. (2008) Immunological aspects of chronic fatigue syndrome. Autoimmun.Rev. (Epub ahead of print).--------(c) 2008 The Feinstein Institute for Medical Research at North Shore LIJ
* * *
Another study that should be required reading for those doctors who tell CFS patients to exercise their way back to health and argue with the patients when they say that exercise makes them worse. It's not my imagination, I'm not making excuses because I don't like exercise -- there's objective evidence that CFS patients have an abnormal response to exercise.